EXERCICI 1

BUSCAR INFORMACIÓ D’UNA SEQÜÈNCIA DESCONEGUDA

 
 

Estàs treballant en un laboratori i has clonat i seqüenciat un fragment de DNA de 420 pb. Primer de tot vols esbrinar si aquest fragment ja ha estat seqüenciat prèviament, ja que en aquest cas potser la seqüència ja ha estat caracteritzada per altres investigadors i pots trobar informació sobre ella en les bases de dades corresponents. Per fer això cal utilitzar un programa anomenat BLASTn que permet buscar seqüències semblants a una que nosaltres tenim. Copia la teva seqüència i enganxa-la al formulari del BLASTn.

 
cttcctgtccaatcgctgcctcaagctggcttaagtcctgctgagattcagcagttatggaaagaagtga
ctggagttcacagtatggaagacaatggcattaaacatggagggctagacctcactactaacaattcctc
ctcgactacctcctccaacacttccaaagcatcaccaccaataactcatcattccatagtgaatggacag
tcttcagttctaagtgcaagacgagacagctcgtcacatgaggagactggggcctctcacactctctatg
gccatggagtttgcaaatggccaggctgtgaaagcatttgtgaagattttggacagtttttaaagcacct
taacaatgaacacgcattggatgaccgaagcactgctcagtgtcgagtgcaaatgcaggtggtgcaacag
 
Les preguntes que vols respondre són:

  1. A quina espècie pertany la seqüència?
  2. Correspon aquesta seqüència a un gen o a una regió no codificant del genoma? Si és un gen, de quin es tracta?
  3. Hi ha seqüències homòlogues en altres espècies properes? En quines espècies? Anomena cinc espècies.

 

Un cop ja saps de quin gen es tracta, vols veure què es coneix sobre aquest gen i la seva funció. Per cercar informació sobre un gen aniràs a una base de dades de gens que s’anomena Entrez Gene. Aquí pots introduir el nom del gen que t’interessa i obtindràs una pàgina amb un munt d’informació sobre aquest gen i enllaços a diferents bases de dades on es donen encara més detalls sobre determinats aspectes. Contesta les següents preguntes:

 
  1. En quin cromosoma es troba aquest gen?
  2. Quins gens té al seu costat?
  3. Quins efectes fenotípics té la mutació d’aquest gen? Causa alguna malaltia?
  4. En quins processos cel·lulars està implicada la proteïna codificada per aquest gen?

 

 
Inici Exercicis